javascript - fast-csv is throwing exception : column header mismatch expected -

-

i trying validate data using fast-csv. code looks 

var filename = req.files.uploadcsv.path; var fs = require("fs");  var stream = fs.createreadstream(filename);  var csv = require("fast-csv");  csv     .fromstream(stream, {         headers: true     })     .validate(function(data) {             if (data.age > 18)                 return false;             else                 return true;          }      }

it works fine every file uploaded if uploaded file data, says error: unexpected error: column header mismatch expected: 5 columns got: 6 file has 5 headers data set contains have 6 records. want catch error can point users error.

please suggest.

i have solved it. solution above problem is:

.on("error", function(data){    return false;                           })

i have implemented code after .validate() , worked.


Comments

Post a Comment

Popular posts from this blog

c++ - QTextObjectInterface with Qml TextEdit (QQuickTextEdit) -

-
i registred handler simple qtextobjectinterface , draws 10x10 red rectangle. when used qtextedit in normal qwidget app, worked. when used qquicktextedit (textedit qml component) in qt quick app, doesn't worked (nothing drawed, rectangle in textedit reserved, because when change cursor position, notice there something, empty space, nothing drawed. qtextobjectinterface intrinsicsize method called (that explains why see there empty space 10x10), drawobject method isn't. i did research , found problem here: qquicktextedit.cpp qt 5.3.0 sources (line 1821) qsgnode *qquicktextedit::updatepaintnode(qsgnode *oldnode, updatepaintnodedata *updatepaintnodedata) { . . . if (textframe->firstposition() > textframe->lastposition() && textframe->frameformat().position() != qtextframeformat::inflow) { updatenodetransform(node, d->document->documentlayout()->frameboundingrect(textframe).topleft()); c...
Read more

xcode - Swift Playground - Files are not readable -

-
Image
files not readable in swift playground . how make files readable? same code runs on xcode terminal app, fails on swift playground. demo code below. import foundation println("hello, world!") var fname:string = "/users/holyfield/desktop/com.apple.iconcomposer.plist" var fm:nsfilemanager = nsfilemanager.defaultmanager() if(fm.fileexistsatpath(fname)){ println("file exists") if(fm.isreadablefileatpath(fname)){ println("file readable") var fd:nsdata? = nsdata(contentsoffile: fname) println(fd?.length) let pl = nsdictionary(contentsoffile: fname) println(pl?.count) println(pl?.allkeys) }else{ println("file not readable") } } else{ println("file not exists") } sample images: i have thank nate cook first quick response , solid answer. just case share answer post, title misleading. see nate's answer here: https://stackoverf...
Read more

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more