python - How do I disable Cython? -

-

i'm trying install lxml in python, seems cython screwing installation (according install instructions).

i'm on centos operating system, , tried yum remove cython, apparently can't find package, though it's there when type whereis.

is there way temporarily disable cython? can't find information anywhere.

edit: tried following:

[root@tawfik devin]# rpm -qa |grep cython [root@tawfik devin]# whereis cython cython: /usr/local/bin/cython [root@tawfik devin]# rpm -e /usr/local/bin/cython error: package /usr/local/bin/cython not installed

use following command find package 

rpm -qa |grep cython

then if found copy past package name in command remove it.

rpm -e <package_name>

Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

oracle11g - get root domain from url Oracle sql regex_substr -

-
i have query root domain urls below : select regexp_substr(regexp_replace('https://creditcards.chase.com/credit-cards/bp-credit-card.aspx', '^http[s]?://(www\.)?|^www\.', '', 1), '(\.\w+)+') domain dual; which returns out put : '.chase.com' how can ignore first dot in outoput regex in above query? note : need root domain, i.e, 'chase.com' thanks. select regexp_substr('https://creditcards.token.chase.com/credit-cards/bp-credit-card.aspx', '(^http[s]?://(www\.)?|^www\.)(\w+\.)*(\w+\.\w+)', 1, 1, 'i', 4) domain dual;
Read more