sigma.js: is there a way to drag-select multiple nodes? -

-

i try drag-select end dragging graph itself. don't see settings can change drag action.

is there way drag-select multiple nodes @ once?

yes, see example: https://github.com/linkurious/linkurious.js/wiki/how-to-select-and-drag-multiple-nodes

with plugin: https://github.com/linkurious/linkurious.js/tree/linkurious-version/plugins/sigma.plugins.dragnodes

linkurious.js provides high-level plugins sigma.js. free open source projects.

disclaimer: work @ linkurious sas.


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

What is the `file` URI scheme in Puppet? -

-
the documentation source attribute file resource type says: the available uri schemes puppet , file . puppet uris ... it explains puppet uri scheme, doesn't file uri scheme. it? mean assign "file://foo/bar/baz" source attribute on file resource? the file path absolute. refers file on system runs catalog. agent system, or machine on invoke puppet apply . file { '/etc/motd': source => "file:///media/shared-storage0/motd/${fqdn}.motd"; } for example, above resource make agent sync motd contents , file metadata shared storage. you can omit file:// , use full path source. source => "/media/shared-storage0/motd/${fqdn}.motd";
Read more