c# - how to display full SQL query run by entity framework LINQ to SQL -

-

say have linq query:

var query = (from person in ctx.people person.name == "john" select person);

ctx context inheriting system.data.entity.dbcontext.

now how full sql query including parameters? have tried:

var sql = ((objectquery) query).totracestring(); sql = query.string(); context.database.log = (s) => sql += s;

the first solution throws invalid cast exception. second solution gives me query part references variables not included. third prints "variables" in strange format.

var query = person in ctx.people person.name == "john" select person; string sql = ctx.getcommand(query).commandtext;


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

What is the `file` URI scheme in Puppet? -

-
the documentation source attribute file resource type says: the available uri schemes puppet , file . puppet uris ... it explains puppet uri scheme, doesn't file uri scheme. it? mean assign "file://foo/bar/baz" source attribute on file resource? the file path absolute. refers file on system runs catalog. agent system, or machine on invoke puppet apply . file { '/etc/motd': source => "file:///media/shared-storage0/motd/${fqdn}.motd"; } for example, above resource make agent sync motd contents , file metadata shared storage. you can omit file:// , use full path source. source => "/media/shared-storage0/motd/${fqdn}.motd";
Read more