ruby - Rails is not routing to my webpage -

-

i new ruby on rails , have been setting demo page test stuff out on app set up, routes aren't being set reason. routing file: http://electrithm.net/routes.rb

trying specifying route like:

get 'hw/hworld', to: 'hw/hworld'

and implement controller+action:

class hwcontroller < applicationcontroller   def hworld      render # should render app/views/hw/hworld.html.erb   end end

Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

java - Values Clustering -

-
in text file data distributed shown below, considering table ease. column1 column2 column3 column4 b 1 2 b 1 5 c 1 3 b c 2 3 c 3 4 b 4 5 i need cluster the same values if column1 , column2 same, a->b repeated 3 times combine this. b 1 2 b 1 5 b 4 5 here's how it. define class record containing 4 fields define class recordkey containing identification of row, i.e. 2 first column values. make sure equals , hashcode defined. create map<recordkey, list<record>> . read records line line. if there list in map current record key, add current record list. otherwise, create new list, add record it, , put list in map.
Read more