ios8 - iOS: Failed to load Asset Catalog JPEG images -

-

according wwdc 2014, asset catalogs support jpeg images format. added jpeg image asset catalog, , referenced image in storyboard. however, image appears white/blank.

i have tried suggestions in "how can add jpegs asset catalog in xcode?", problem still exists.

your appreciated!

did try set 'render as..' option image 'always original' in right panel of asset catalog editor?


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

Define custom list-style-type in CSS -

-
i want ask, if possible (something font-face). example: @list-style-type { list-style-image: 'mycustomstyle'; src: url('url-to-image'); } ul { list-style-type: mycustomstyle; } is there that? know can classes on element , set custom image, not point. have issue company , nice. in css defined , implemented, cannot. values of list-style-type property set of keywords, different in different specifications , implementations, syntax not allow custom values added. there work in progress define css lists , counters module level 3 , extend syntax , semantics, allow custom values defined in @counter-style rules, using constructs designed part of css counter styles level 3 . planned include possibility of defining named value uses custom image, or construct contains custom image part of it. far, seems there no implementations of in released versions of browsers.
Read more