Bring up vagrant boxes simultaneously -

-

vagrant brings 1 box @ time. there way make vagrant bring boxes @ same time?

the vagrantfile configuration i'm using several boxes has following format:

vagrant.configure("2") |config|   config.vm.define :master |master|     # master config...   end    config.vm.define :slave1 |slave|     # slave config...   end end

now, when running > vagrant up vagrant start setting master , once done set slave1.

depending on provider, can pass pass --parallel flag vagrant up. vagrant --parallel 

as of march 17th, mitchell hashimoto noted virtualbox not provider supports parallelism. reference


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

java - Values Clustering -

-
in text file data distributed shown below, considering table ease. column1 column2 column3 column4 b 1 2 b 1 5 c 1 3 b c 2 3 c 3 4 b 4 5 i need cluster the same values if column1 , column2 same, a->b repeated 3 times combine this. b 1 2 b 1 5 b 4 5 here's how it. define class record containing 4 fields define class recordkey containing identification of row, i.e. 2 first column values. make sure equals , hashcode defined. create map<recordkey, list<record>> . read records line line. if there list in map current record key, add current record list. otherwise, create new list, add record it, , put list in map.
Read more