xamarin.ios - Custom controls not visible in the View -

-

below code used create custom uitextfield in code behind.

uitextfield usernamefield;

usernamefield = new uitextfield
{
placeholder = "enter username",
borderstyle = uitextborderstyle.roundedrect,
frame = new rectanglef(10, 32, 50, 30)
};

view.addsubview(usernamefield);

but when run app, dont see anywhere. not control controls create in code behind. if drag controls toolbox onto view it's working fine. might cause?

make sure container view not transparent alpha = 1 , set background colors appropriate controlls. because default set clear

you can use method easly set background , rounded corners in older versions of ios
public static void makeviewrounded(uiview view,float cornerradius, monotouch.coregraphics.cgcolor backgroundcolor) { view.layer.cornerradius = cornerradius; view.layer.backgroundcolor = backgroundcolor; }
also make sure adding custom controll viewcontroller/view


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

oracle11g - get root domain from url Oracle sql regex_substr -

-
i have query root domain urls below : select regexp_substr(regexp_replace('https://creditcards.chase.com/credit-cards/bp-credit-card.aspx', '^http[s]?://(www\.)?|^www\.', '', 1), '(\.\w+)+') domain dual; which returns out put : '.chase.com' how can ignore first dot in outoput regex in above query? note : need root domain, i.e, 'chase.com' thanks. select regexp_substr('https://creditcards.token.chase.com/credit-cards/bp-credit-card.aspx', '(^http[s]?://(www\.)?|^www\.)(\w+\.)*(\w+\.\w+)', 1, 1, 'i', 4) domain dual;
Read more

xcode - Swift Playground - Files are not readable -

-
Image
files not readable in swift playground . how make files readable? same code runs on xcode terminal app, fails on swift playground. demo code below. import foundation println("hello, world!") var fname:string = "/users/holyfield/desktop/com.apple.iconcomposer.plist" var fm:nsfilemanager = nsfilemanager.defaultmanager() if(fm.fileexistsatpath(fname)){ println("file exists") if(fm.isreadablefileatpath(fname)){ println("file readable") var fd:nsdata? = nsdata(contentsoffile: fname) println(fd?.length) let pl = nsdictionary(contentsoffile: fname) println(pl?.count) println(pl?.allkeys) }else{ println("file not readable") } } else{ println("file not exists") } sample images: i have thank nate cook first quick response , solid answer. just case share answer post, title misleading. see nate's answer here: https://stackoverf...
Read more