php - CURL Showing Different data and Original page showing different -

-

i used scrap data different websites, came across issue original site showing different data when used curl fetch data showing different data. clarify point attaching screen shots of both pages.

original image original image

curl image enter image description here

do guys having suggestions point me doing wrong? site http://www.whatsthescore.com/

and curl request 

$url ='http://www.whatsthescore.com/'; $ch = curl_init(); curl_setopt($ch, curlopt_autoreferer, true); curl_setopt($ch, curlopt_header, 0); curl_setopt($ch, curlopt_returntransfer, 1); curl_setopt($ch, curlopt_url,$url); curl_setopt($ch, curlopt_followlocation, true);        $data = curl_exec($ch); curl_close($ch); echo $data;

any suggestions ?


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

oracle11g - get root domain from url Oracle sql regex_substr -

-
i have query root domain urls below : select regexp_substr(regexp_replace('https://creditcards.chase.com/credit-cards/bp-credit-card.aspx', '^http[s]?://(www\.)?|^www\.', '', 1), '(\.\w+)+') domain dual; which returns out put : '.chase.com' how can ignore first dot in outoput regex in above query? note : need root domain, i.e, 'chase.com' thanks. select regexp_substr('https://creditcards.token.chase.com/credit-cards/bp-credit-card.aspx', '(^http[s]?://(www\.)?|^www\.)(\w+\.)*(\w+\.\w+)', 1, 1, 'i', 4) domain dual;
Read more

xcode - Swift Playground - Files are not readable -

-
Image
files not readable in swift playground . how make files readable? same code runs on xcode terminal app, fails on swift playground. demo code below. import foundation println("hello, world!") var fname:string = "/users/holyfield/desktop/com.apple.iconcomposer.plist" var fm:nsfilemanager = nsfilemanager.defaultmanager() if(fm.fileexistsatpath(fname)){ println("file exists") if(fm.isreadablefileatpath(fname)){ println("file readable") var fd:nsdata? = nsdata(contentsoffile: fname) println(fd?.length) let pl = nsdictionary(contentsoffile: fname) println(pl?.count) println(pl?.allkeys) }else{ println("file not readable") } } else{ println("file not exists") } sample images: i have thank nate cook first quick response , solid answer. just case share answer post, title misleading. see nate's answer here: https://stackoverf...
Read more