windows phone 8 - Disable action center WinJS -

-

i'm developping winjs application on windows phone 8 , want "disable" action bar. want when touch top of screen doesn't show action bar. saw several games doing : image example

how can html or winjs ?

you need 2 things:

  1. hide status bar via statusbar.hideasync method
  2. disable system overlays via applicationview.suppresssystemoverlays property.

you need both things minimize action center popup thing.


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
Read more

amazon web services - The request could not be satisfied in while using <alphaNumeric-string>.cloudFront.net -

-
here facing same issue. got cname alias aws.phonon.in working perfectly. got scenario have redirect users cloudfront.net url mapped cname. below details: https://aws.phonon.in/c2creports/resource/images/phononlogo.png link works expected. aws.phonon.in mapping record : d1f4zd5av6bosa.cloudfront.net if try hit url: https://d1f4zd5av6bosa.cloudfront.net/c2creports/resource/images/phononlogo.png i 502 bad gateway error. i'm able telnet on both port 80 , 443. can provide more details please me out of this....
Read more