Convert json into tree structure using javascript, client side -

-

i want convert following json code have collected using requests tree structure

"rules": [{   "name": "rule1",   "isfirst": true,    "conditions": [{     "outcometrue": {       "gotorule": "rule2"     },     "outcomefalse": {       "changestatus": {         "gotorule": "26"       }     },     "outcomeerror": {       "changestatus": {         "gotorule": "27"       }     },   }], },{   "name": "rule2",   "isfirst": false,   "conditions": [{     "name": "history check idnumber",     "outcometrue": {         "gotorule": "27"     },     "outcomefalse": {       "gotorule": "rule3"     },     "outcomeerror": {       "gotorule": "26"     },    }], }]

into this. normal graph this:

a tree graph structure

have @ d3.js' tree

live example

edit: example: d3.js tree diagram generated 'flat' data (uses array of objects)


Comments

Post a Comment

Popular posts from this blog

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
Read more

amazon web services - The request could not be satisfied in while using <alphaNumeric-string>.cloudFront.net -

-
here facing same issue. got cname alias aws.phonon.in working perfectly. got scenario have redirect users cloudfront.net url mapped cname. below details: https://aws.phonon.in/c2creports/resource/images/phononlogo.png link works expected. aws.phonon.in mapping record : d1f4zd5av6bosa.cloudfront.net if try hit url: https://d1f4zd5av6bosa.cloudfront.net/c2creports/resource/images/phononlogo.png i 502 bad gateway error. i'm able telnet on both port 80 , 443. can provide more details please me out of this....
Read more

What is the `file` URI scheme in Puppet? -

-
the documentation source attribute file resource type says: the available uri schemes puppet , file . puppet uris ... it explains puppet uri scheme, doesn't file uri scheme. it? mean assign "file://foo/bar/baz" source attribute on file resource? the file path absolute. refers file on system runs catalog. agent system, or machine on invoke puppet apply . file { '/etc/motd': source => "file:///media/shared-storage0/motd/${fqdn}.motd"; } for example, above resource make agent sync motd contents , file metadata shared storage. you can omit file:// , use full path source. source => "/media/shared-storage0/motd/${fqdn}.motd";
Read more