Posts

Featured post

c - CUDA code not processing if block properly -

-
stuck @ if block right below //step 5, issue code not progress or after given if block. need figure out how particular issue settled before starting task of generating parallel code. if run code see 1 print statement indicates value of "one" , 2 "i" , "j". after if block begins, none of other print statements hit. result quite stuck, aware specific issue, however, cannot seem determine it's cause. any appreciated! in advance! input file sample. >386.fasta.screen.contig1 gagtttgatcctggctcagaatcaacgctggcggcgcgcttaacacatgc aagtcgaacgagaaagtggagcaatccatgagtacagtggcgtacgggtg agtaacacgtgggtaatctacctcttagtggggaataactttgggaaacc gaagctaataccgcataagctcgagagaggaaagcagcaatgcgctgaga gaggagcccgcggccgattagctagttggcagggtaaaagcctaccaagg cagagatcggtagccggcctgagagggcacacggccacactggcactgaa acacgggccagactcctacgggaggcagcagtggggaatcttgcacaatg ggggcaaccctgatgcagcgacgccgcgtgagcgatgaagcccttcgggg tgtaaagctctttcgtcagggaagatagtgacggtacctggagaagcagc tgcggctaactacgt...
1 comment
Read more

Android Capture Image From Camera -

-
i making application in i'm using camera function of android. i'm opening camera , taking picture.in simple way easy do. but want take picture camera when user touch on anywhere on opened camera screen. (like use focus functionality) thank in advance , sorry bad english.
2 comments
Read more

java - Values Clustering -

-
in text file data distributed shown below, considering table ease. column1 column2 column3 column4 b 1 2 b 1 5 c 1 3 b c 2 3 c 3 4 b 4 5 i need cluster the same values if column1 , column2 same, a->b repeated 3 times combine this. b 1 2 b 1 5 b 4 5 here's how it. define class record containing 4 fields define class recordkey containing identification of row, i.e. 2 first column values. make sure equals , hashcode defined. create map<recordkey, list<record>> . read records line line. if there list in map current record key, add current record list. otherwise, create new list, add record it, , put list in map.
1 comment
Read more

What is the `file` URI scheme in Puppet? -

-
the documentation source attribute file resource type says: the available uri schemes puppet , file . puppet uris ... it explains puppet uri scheme, doesn't file uri scheme. it? mean assign "file://foo/bar/baz" source attribute on file resource? the file path absolute. refers file on system runs catalog. agent system, or machine on invoke puppet apply . file { '/etc/motd': source => "file:///media/shared-storage0/motd/${fqdn}.motd"; } for example, above resource make agent sync motd contents , file metadata shared storage. you can omit file:// , use full path source. source => "/media/shared-storage0/motd/${fqdn}.motd";
1 comment
Read more

Define custom list-style-type in CSS -

-
i want ask, if possible (something font-face). example: @list-style-type { list-style-image: 'mycustomstyle'; src: url('url-to-image'); } ul { list-style-type: mycustomstyle; } is there that? know can classes on element , set custom image, not point. have issue company , nice. in css defined , implemented, cannot. values of list-style-type property set of keywords, different in different specifications , implementations, syntax not allow custom values added. there work in progress define css lists , counters module level 3 , extend syntax , semantics, allow custom values defined in @counter-style rules, using constructs designed part of css counter styles level 3 . planned include possibility of defining named value uses custom image, or construct contains custom image part of it. far, seems there no implementations of in released versions of browsers.
1 comment
Read more

oracle11g - get root domain from url Oracle sql regex_substr -

-
i have query root domain urls below : select regexp_substr(regexp_replace('https://creditcards.chase.com/credit-cards/bp-credit-card.aspx', '^http[s]?://(www\.)?|^www\.', '', 1), '(\.\w+)+') domain dual; which returns out put : '.chase.com' how can ignore first dot in outoput regex in above query? note : need root domain, i.e, 'chase.com' thanks. select regexp_substr('https://creditcards.token.chase.com/credit-cards/bp-credit-card.aspx', '(^http[s]?://(www\.)?|^www\.)(\w+\.)*(\w+\.\w+)', 1, 1, 'i', 4) domain dual;
1 comment
Read more

amazon web services - The request could not be satisfied in while using <alphaNumeric-string>.cloudFront.net -

-
here facing same issue. got cname alias aws.phonon.in working perfectly. got scenario have redirect users cloudfront.net url mapped cname. below details: https://aws.phonon.in/c2creports/resource/images/phononlogo.png link works expected. aws.phonon.in mapping record : d1f4zd5av6bosa.cloudfront.net if try hit url: https://d1f4zd5av6bosa.cloudfront.net/c2creports/resource/images/phononlogo.png i 502 bad gateway error. i'm able telnet on both port 80 , 443. can provide more details please me out of this....
Post a Comment
Read more